Creation vs. Evolution
- Thread starter ledhed
- 9,687 comments
- 447,263 views
- 87,631
- Rule 12
- GTP_Famine
Yep.
It doesn't stop some though. I mean, we'll doubtless see a claim in a minute from you that some fossils don't yield enough soft tissue for us to conduct phylogenetic tests on them to determine their historical taxonomy. This is, of course, true, but misses the point. Evolution deniers use it to dismiss the entire fossil record as unproven, but the point of phylogenetics is that it only reinforces the taxonomy of fossils that has been documented previously.
Evolution through natural selection allows us to classify fossils from antiquity with a very high level of accuracy. Molecular biology allows us to confirm it.
Of course, if you have a better explanation - that fits all the known facts and laws, naturally, to be elevated to the lofty position of theory - that tells us why we observe increasing complexity in fossilised organisms over geological time and myriad intermediate forms between earlier dated fossils (and species) and later dated fossils (and species) up to the wide array of lifeforms still existing on this planet today, the majority of which have no examples in the fossil record at any time in the last 100,000 years, the scientific community would gladly receive it and evaluate it.
Molecular biology has really nailed the coffin shut for those who'd seek to claim that the notion of evolution through natural selection doesn't occur.
It doesn't stop some though. I mean, we'll doubtless see a claim in a minute from you that some fossils don't yield enough soft tissue for us to conduct phylogenetic tests on them to determine their historical taxonomy. This is, of course, true, but misses the point. Evolution deniers use it to dismiss the entire fossil record as unproven, but the point of phylogenetics is that it only reinforces the taxonomy of fossils that has been documented previously.
Evolution through natural selection allows us to classify fossils from antiquity with a very high level of accuracy. Molecular biology allows us to confirm it.
Of course, if you have a better explanation - that fits all the known facts and laws, naturally, to be elevated to the lofty position of theory - that tells us why we observe increasing complexity in fossilised organisms over geological time and myriad intermediate forms between earlier dated fossils (and species) and later dated fossils (and species) up to the wide array of lifeforms still existing on this planet today, the majority of which have no examples in the fossil record at any time in the last 100,000 years, the scientific community would gladly receive it and evaluate it.
Obviously,
I did NOT claim that the notion of evolution through natural selection doesn't occur.
I did NOT say that some fossils don't yield enough soft tissue for us to conduct phylogenetic tests on them , It's you !
I did NOT dismiss the entire fossil record as unproven.
I did NOT deny increasing complexity in fossilised organisms over geological time.
My question was-again- Can we know if one particular fossil evolved from another ?
- 2,351
- Gold Coast
- drbrg
- Silv3rEy3d
- 1,085
- Barcelona
- Missing
- Halo v8
Yes. Basically, DNA is represented as a very long string of letters (composed of A, T, C and G).
Part of the DNA sequence of a fish fossil could be something like this:
ATCGATGCGATGAGCGATATATGC
Part of the DNA sequence of an amphibian fossil could look like this (differences in bold):
ATCGACGCGATGATCGATATATGA
That similarity in the DNA would tell us that the amphibian is the offspring of an offspring of an offspring...(repeat quite a few times)...of an offspring of the fish.
Last edited:
- 282
- Newc, England
- SafffOneee
- Saf4
If I had my way, it would be illegal to be "born into" a religion, or in other words brainwashed when you are most vulnerable to believe what you are taught. Religion is a big ****ing deal, atleast to people around you, and depending on the religion and your level of faith can completely govern the rest of your life. I have seen firsthand so much fear, oppression and retribution, and for those who don't submit the inevitable paranoia due to the "what if" - completely irrational but if people ground it into you when you were young I can't truly escape. All of that from people that are of a religion, 99% simply because they were born into it! It's ****ED.
My law: Get ****ing educated, make an informed choice at min. 18. Least enforcable law in the world but we have to start somewhere. Leave the innocent children the **** alone. They see enough without wanting it for themselves.
My law: Get ****ing educated, make an informed choice at min. 18. Least enforcable law in the world but we have to start somewhere. Leave the innocent children the **** alone. They see enough without wanting it for themselves.
- 3,207
It's not an easy thing to do.
Other than in specimen where DNA is available, we have to work with what we have in terms of fossilized hard parts and ichnology. And what we have is a very small biased representation of what was living at any time in the past. The factors determining preservation are working against us, organic compounds need ideal conditions (very rare) for preservation, the fossil record favours the preservation of smaller organisms, cause of death is a factor (fast burial is good for preservation, almost everything else isn't), and then what happens after death (diagenesis, metamorphism, weathering), and whether the fossil is uplifted to the surface or shallow subsurface for the present time. The chances any marine organism is preserved is very very small, for terrestrial organisms it is even smaller. Simply put, the vast majority of organisms are not preserved.
Nevertheless, we do what we can in terms of classifying the fossil record and it's clear how evolution drives diversity based mostly on morphology. It is difficult at the genus and family level (many species are still argued or changed, especially at the genus level), but we have a fairly good grasp at how orders, classes, and phyla are connected by evolution. Yes, we are missing documentation of a great number of species, but that does not discredit the connections we have made, most importantly at higher ranks.
To answer your question: We use the gradual changes in characteristics in different organisms over time to give us a map of speciation. Due to the problems with the fossil record, it may be difficult in certain individual cases, but overall patterns of speciation are obvious and well documented.
Thanks but this has nothing to do with proving that you came from microbe-like structure & imply imagination more than evidence-based science.
Besides, you assert that neo-darwinism is true in the first place to reach that conclusion.
We know that rRNA is used to classify organisms, What is the proof that you evolved from microbe-like structure which is radically different from you in terms of rRNA & DNA.
Thanks.
The problem is that fossil record per se. doesn't imply anythng evolved from anything, besides no one told me why if a creature lived after another then it's automatically assumed to be its ancestor by some people just due to some degree of similarity in certain organ which is funny enough to claim this has anything to do with "proving" anything.
Does that mean i came from similar microbes ?
Last edited by a moderator:
- 1,678
- Canada
- TheDrummingKING
The fact that you call it neo-darwinism shows, to me, that you are not willing to learn anything on the subject. So tell me, why should anyone waste their time answer your questions (especially if you're just going to say "Oh that doesn't count answer this instead" like you have done multiple times already).
Also there is an edit button so you don't have to quadruple post.
Evolution is NOT neo-darinism. Obviously you don't know what I am talking about.
Scientifically speaking, because microbes lived long time ago & other animals lived recently, this doesn't provide evidence that the first is ancestor to others, if you have scientific evidence for the opposite , Go ahead.
" Ancestors are linked by DNA or other similarities" This is a fact. HOWEVER non-ancestors may be similar too. Do you look similar to the microbes ?
Last edited:
- 4,035
- Gothenburg
- Agremont
Is there any evidence-based science you can provide instead !!
It's a theory that tried to apply mandelian genetics on the failed darwin theory because he didn't knew about it. However, I didn't find any evidence that a microbe can transform to man yet based on the fact that microbes are still naturally selected millions of years ago.
- 1,678
- Canada
- TheDrummingKING
- 87,631
- Rule 12
- GTP_Famine
I already did. You dismissed them on the grounds they're only ways to classify organisms - which is exactly what you're asking for...
Nope.
Nope.
Evolution through natural selection - Darwin's observations and conclusion - and Mendelian genetics - heritable characteristics passed through germ cells - are part of the evolutionary theory.
- 3,207
We can observe evolution in the present (in the lab, artificial selection, etc.), therefore evolution is implied to have driven speciation in the fossil record.
Unless, of course, you can come up with a plausible alternate hypothesis for the gradual appearance (and to a degree, disappearance) of species in the fossil record? I'm all ears.
Calm down
Evolution is a scientific fact.
Neo-darwinism is not supported by proof except a trial to "classify", then asserting that man & microbes "must be" related which is obviously not evidence-based.
when the oldest bacteria fossils emerge, some 3.5 billion years ago, atmospheric and temperature conditions at the time were not at all suited to support complex creatures or human beings. Th cambrian period, which refers to some 530 million years ago, was definitely unsuitable for human life. (There were no land animals at all at that time.)
The situation is the same in the great majority of succeeding periods. Examination of the fossil record shows that conditions able to support human life have only existed for the last few million years. The same applies to all other living things.
Why ?
Dawkins, comments on another problem:
For example the Cambrian strata of rocks… are the oldest ones in which we find most of the major invertebrate groups. And we find many of them already in an advanced state of evolution, the very first time they appear. It is as though they were just planted there, without any evolutionary history.
Both schools of thought ('punctuationists' and 'gradualists') agree that the only alternative ( to imperfections of the fossil record ) explanation of the sudden appearance of so many complex animals types in the Cambrian era is divine creation, and both would reject this alternative." (Dawkins, Richard, The Blind Watchmaker," 1986, p.229-230)
It seems to me more related to religious commitment other than anything else related to science & evidnce.
(Taking in consideration that similarity doesn't prove common ancestry)
Last edited:
- 1,678
- Canada
- TheDrummingKING
Scaff
Moderator
- 29,760
- He/Him
- ScaffUK
Given that this thread is Creation vs Evolution and not Creation vs Neo-Darwinism, combined with the fact that the term Neo-Darwinism is commonly used to describe Evolution (by even the EB), and that you state you accept Evolution as fact yet claim that some of the elements that prove it are not proof (DNA).
As such the confused nature of your posts are not helpful at all.
The problem is that some persons use examples of ''the change of allele frequencies of a population over time'' (scientific evolution) to prove 'the idea that all life has descended from a single common ancestor over millions of years via a net gain in new genetic information' (microbe-like-to-man evolution="neo-darwinism,". To avoid confusion, we had to define what we mean by evolution firstly, That's correct.
